Sample exam questions

Biology 2250 - Principles of Genetics - Dr. Carr

Sample exam questions (for Midterms I & II, & Final Exam)

These examples are intended to show the STYLE of questions that MAY be asked on exams, NOT the specific questions that will be asked.

For all exams, you will be given a sheet with the Universal Genetic Code: it is therefore not necessary to memorize the genetic code.

I. MOLECULAR BIOLOGY: For each question, indicate in the space provided the LETTER of the ONE response that best answers the question.

______ In double-stranded RNA regions, the bonds that hold complementary nucleotides together are described as
A. ionic B. covalent C. hydrophobic D. hydrogen E. hydrophilic

______ The teritary structure of protein is determined by
A. beta sheets B. hydrogen bonds C. disulfide bonds D. alpha helices E. subunit arrangement

______ The active site of an enzyme is most likely to be composed of amino acids with the following characteristics:
A. Polar & Hydrophobic B. Polar & Hydrophilic C. Non-polar & Hydrophobic D. Non-polar & Hydrophilic

______ Semi-conservative DNA replication was demonstrated by

A. Watson & Crick B. Meselson & Stahl C. Hershey & Chase D. Luria & Delbruck E. Penn & Teller

II. MOLECULAR GENETICS. Each of the following five statements contains a basic misconception about genetics. In not more than three grammatically complete sentences, identify and correct the error. Do NOT exceed the space provided. Do NOT draw diagrams.

Ex.: "Because it has higher energy, gamma radiation is always more mutagenic than alpha radiation."

                Sample answer: Gamma radiation is more energetic than alpha, but that energy is dispersed over a much longer path length, so it has a lower linear energy transfer (LET) than alpha radiation.
                                    The higher LET of alpha radiation means that its lower energy will be dispersed over a very short path.
                                    If the energy is released within the nucleus of a single cell near a chromosome, it will be highly mutagenic.

Ex: "Brown eyes (B) are dominant to blue eyes (b). Both of my parents have brown eyes, but I have blue eyes. Since eye colour is genetic, I must be adopted."

Sample answer: Eye colour is likely a polygenic trait (with multiple genes involved), so its inheritance is not that simple.
Even if it were a simple Mendelian trait, your parents might both be Bb heterozygotes for brown eyes, and you could be a blue-eyed bb homozygote with blue eyes.

Ex.: "DNA probes anneal to particular SNPs and are responsible for genetic diseases."

Ex.: "Met^- mutants are caused by a defect of methionine that block its synthesis."

Ex.: "Most people do not have Cystic Fibrosis because they do not have the gene for Cystic Fibrosis."

______ If the template strand of a piece of DNA reads 3' - AAAAAATTT - 5', its protein product will read:
A. H₃N - F F K - COOH B. HOOC - F K K - NH₃ C. H₃N - K F F - COOH D. HOOC - K K F - NH₃

III. MENDELIAN GENETICS. For each question, indicate in the space provided the LETTER of the ONE response that best answers the question.

    ______ A woman is heterozygous for an X-linked recessive allele that causes night-blindness. If she marries a man with night-blindness, what proportions of her female & male offspring will carry the night-blindness allele?
                    A) all, none      B) all, half      C) half, half      D) half, none    E) none, half    F) none, all

    ______ In Trufula trees, the locus for leaf colour has three alleles: R (red), G (green), and B (brown). R is dominant to G, G is dominant to B. In the progeny of the cross BR x BG, what fraction will be brown ?
                        A) All        B) 3/4        C) 1/2        D) 1/4        E) 0

______ Two individuals heterozygous for semi-dominant traits at four loci are crossed: how many F₂ genotypes are expected?
A) 4 B) 9 C) 16 D) 27 E) 32 F) 64 G) 81

IV. GENETIC STRUCTURES: The numbers in the left-hand column refer to structures on the right. For each numbered structure, write the letter of the correct term [see example]. Several letters are not used; none is used more than once.

V. DNA TRANSCRIPTION & TRANSLATION [Use the Genetic Code table attached to the test]

The following DNA is part of a gene that codes for a polypeptide of at least seven amino acids:

3' caattgattagtcagtcaattgat 5'
5' gttaactaatcagtcagttaacta 3'

i. Which strand includes an Open Reading Frame? Top (T) or Bottom (B) [2 pts]

   ii. Which DNA strand is the sense strand? Top (T) or Bottom (B) [2 pts]

   iii. Give the mRNA sequence that would be transcribed from this gene; label the 5' & 3' ends. [3 pts]

   iv. Give the seven amino acids that would be translated from the correct message; label the C & N ends. [5 pts]

VI. PEDIGREE ANALYSIS: Given the pedigree shown, which of the six modes of inheritance are possible? Which is most likely? What observations would change this?

VII. TRIHYBRID THREE-POINT TEST CROSS: From the following recombination data, draw a physical map to indicate the correct order and distances between loci.

VIII. RESTRICTION MAPPING: From the following fragment size data, draw a restriction map. Label the sites, provide a scale. [10 pts possible]

Types of questions I would not ask.

Transcription proceeds in which of the following directions (a) 3' 1' (b) 2' 4' (c) 3' 5' (d) 4' 6' (e) 5' 3'

Which of the following amino acids is/are non-polar? (a) Ala (b) Gly (c) Arg (d) Asp (e) Two of these (f) All of them

Draw the structure of Deoxyadenosine monophosphate.

Outline the process of DNA replication.

What are the clues for sex-linked inheritance?

How many introns are present in the chicken ovalbumin gene? (a) 4 (b) 5 (c) 6 (d) 7 (e) more than 7