Bio2250 - Principles of Genetics
Name _________________________ Lab Slot _____
[http://www.mun.ca/biology/scarr/2250_BLAST_A.html] A9331
ataaacccattcatctctattattacatttacaacactcatcctaagcacaacaattgta
70bp DNA sequence from the Fortune Bay "Sea Monster"
DNA testing was used to identify the
“sea monster” that washed onshore at St. Bernard’s, Fortune Bay, Newfoundland, in August 2001. The test involves the polymerase
chain reaction, which generates a large number of DNA copies from a single
original gene. The sequence of the gene can then be determined on an automated
DNA sequencer. The identification is made by means of a BLAST search (Basic Local Alignment and Search Tool), which compares the degree of similarity ("match") of an unknown DNA sequence to the
library of all known DNA sequences. BLAST is one of several bioinformatic tools available from the National Center for Biotechnology Information.
To make this identification from the DNA data above:
Copy the
above DNA sequence
Go to the NCBI
BLAST site [ http://www.ncbi.nlm.nih.gov/BLAST ]; Request a "nucleotide
- nucleotide BLAST"; Choose the 'nr' database;
Paste
the DNA sequence into the Search box;
Hit
the BLAST! button; Hit the FORMAT button, wait for result
What is the Sea Monster?
1. Report Identities X / Y (Z%) & e-score: What do these numbers mean?
2. Scientific name [genus + species, family, order, class]:
3. Common name: Based on web information, discuss distribution and biology briefly
4. Is this identification reasonable for the "sea monster" above? If not, what are some possible explanations?
Useful links:
Modern Genetic Analysis 2 website: [http://bcs.whfreeman.com/mga2e/] click on link to "online bioinformatics"
Nation Center for Biotechnology Information (NCBI) home: [http://www.ncbi.nlm.nih.gov]
"Helix & Primer" Genomics & DNA sequencing laboratory [http://www.mun.ca/biology/scarr/Helix_&_Primer.htm]
All
text material
©2007 by Steven M. Carr
