M  N  M  A  L  T  L  F  T  N  T  A  L  A  S  L  L  V  L  I  A  F  W  L  P  Q  L
PHOCND3    ATAAACATAGCACTAACCCTATTTACCAACACAGCCCTGGCCTCTCTACTCGTACTAATTGCATTCTGACTCCCTCAGCT
           |||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||
HALIND3    ATAAACATAGCATTAACCCTATTTACCAACACAGCCCTAGCCTCTCTACTCGTACTAATTGCATTCTGACTCCCTCAGCT
           |||||| |   ||||||  |  | || ||   | ||||||| ||  |||| |||||||| ||||||||||| || |||||
CANIND3    ATAAACGTTATATTAACTTTGATAACTAATGTAACCCTAGCATCCTTACTTGTACTAATCGCATTCTGACTTCCCCAGCT
           ||||| || ||| |  | ||  | || |||  |  |||  |  |  |||||||||| |||||||||||| | ||||| ||
FELIND3    ATAAATGTAATACTTGCCTTACTTACCAATACACTCCTGTCCACACTACTTGTACTCATCGCATTCTGATTACCCCAACT

"Universal" PCR primer design in the mtDNA ND3 region

    The diagram shows part of the DNA sequences of the ND3 subunit gene from the mitochondrial DNA of four species of mammalian Carnivora, Harbour Seal (Phoca), Grey Seal (Halichoerus), domestic dog (Canis), and domestic cat (Felis). The nucleotide region shown in colour is a potential PCR primer site, a region of  >25 bp region that is identical between seal species sequences and  >92% identity with the canid and / or felid sequences. This primer, paired with another a few hundred or few thousand bases away, will likely amplify the gene region for most species of Carnivora.


All figure and text material 2013 by Steven M. Carr