Biochemistry 3107 - Fall 2002

Protein Synthesis: The Ingredients

Before starting to study the web notes on Protein Synthesis, you may wish to review the basic events by viewing an animation from Joachim Frank, Amy B. Heagle, and Rajendra K. Agrawal (1999) "Animation of the Dynamical Events of the Elongation Cycle Based on Cryo-Electron Microscopy of Functional Complexes of the Ribosome," Journal of Structural Biology, 128:1. [picture (right) linked from Translation: Protein Synthesis by Joyce J. Diwan - also a good source]

The following "ingredients" are required for protein synthesis:

• Aminoacylated tRNAs
• Ribosomes
• An mRNA
• Ancillary Protein "Factors"
• A special tRNA for Initiation

Aminoacylation of Transfer RNA

The addition of the correct amino acid to the correct tRNA is possibly the most critical step in gene expression. If this is not done correctly, then the Genetic Code would effectively be meaningless.

[26-8]

Once the amino acid has been added to the tRNA, it will be used for protein synthesis according to the specificity dictated by the anticodon sequence in the tRNA. This was demonstrated by the classic Raney Nickel Experiment carried out by Seymour Benzer's group in 1962.

[Lod4-36]

In this experiment, cysteinyl-tRNA^Cys was reacted with nickel hydride, which causes desulfurization of the amino acyl moiety, to form alanly-tRNA^Cys. This tRNA, which recognizes cysteine anticodons, directed the incorporation of alanine into proteins in place of cysteine. In other words, the protein synthesizing machinery was unable to detect that the incorrect amino acid was attached to tRNA^Cys.

The aminoacylation of tRNAs is carried out by a family of enzymes called aminoacyl tRNA synthetases (aaRS). In E. coli, there are 21 enzymes -- one for each amino acid except lysine which has two. It used to be thought that this was a general rule; i.e. one enzyme per amino acid. However, it is now clear that this is not the case. Some organisms have fewer than 20 AARS's and modify amino acids after they have been added to tRNA.

 

• In thermophilic methanogens, there is no CysRS. Instead ProRS catalyses the addition of cysteine onto its cognate tRNA as well as the addition of proline onto its cognate tRNA.
  
• Giardia lamblia has AlaRS and CysRS that are structurally similar to other eukaryotic aaRS enzymes but it also contains ProRS which is similar to that found in the archaebacterial methanogens and which also has dual specificity.
  
• Some aaRS enzymes are not essential for cell viability indicating that there are alternative pathways for charging some tRNAs.
  
• In many cases, Glu-tRNA is amidated to Gln-tRNA and Asp-tRNA is amidated to Asn-tRNA.

 

It is now clearly established that there are at least two ways of forming aminoacyl-tRNA.

(1) direct acylation of tRNA by aminoacyl-tRNA synthetases

this ATP-dependent reaction is carried out by enzymes which, in general, are exceedingly specific in selecting their substrates, i.e., amino acid and tRNA.

[image]

 

(2) indirect pathway of aminoacyl-tRNA synthesis

this pathway relies on the acylation of tRNA with a "precursor" amino acid by a nondiscriminating aaRS

Our current knowledge about the number and nature of these enzymes is still far from complete, but it is clear that in many organisms this is the essential and only way to form Asn-tRNA and Gln-tRNA.

E. coli uses glutaminyl-tRNA synthetase

Bacillus subtilis employs Glu-tRNA^Gln amidotransferase

 

There are a number of important aspects of the mechanism of action of aminoacyl-tRNA synthetases to consider:

 

• The mechanism of the addition reaction itself.
  
  
• The mechanism by which the amino acyl tRNA synthetase recognizes the correct tRNA.
  
  
• The mechanism by which the amino acyl tRNA synthetase recognizes the correct amino acid.

 

Mechanism of Aminoacylation

Aminoacylation of the tRNA proceeds through a 2 step reaction mechanism that can be summarized as:

[26-aa-AMP.jpg]

Step 1: Activation of the Amino Acid

aa + ATP <=> aa~AMP + PP_i

 

Step 2: Transfer of the aminoacyl group to the tRNA

aa~AMP + tRNA <=> aa-tRNA + AMP

 

[MVH27-10]

both steps occur in the active site of the enzyme; there is no dissociation of the aminoacyl-adenylylate intermediate from the active site during the reaction.

The transfer of the aminoacyl group to the tRNA in step 2 above can take place to either the 2' or the 3' hydroxyl group of the 3' terminal nucleotide of a tRNA. Aminoacyl tRNA synthetases (aaRS's) can be divided into two classes on the basis of which hydroxyl group is used. This preference is also reflected in structural differences among the two classes of enzyme (image):

	IMAGE FROM: Michael Ibba and Dieter Söll (2000) AMINOACYL-TRNA SYNTHESIS. Annu. Rev. Biochem. 69:617-650.
	NOTE: The image at leftmay be restricted to users from licensed or registered sites.

 

Class I	Arg, Cys, Gln, Glu, Ile, Leu, Met, Trp, Tyr, Val
Class II	Ala, Asn, Asp, Gly, His, Lys, Phe, Pro, Ser, Thr

 

Class I enzymes catalyze the addition of the aminoacyl group to the 2' hydroxyl group of the 3' terminal nucleotide; they are mostly monomeric proteins. Class I enzymes contain a Rossmann nucleotide fold (characterized by the HIGH and KMSK motifs).

Class II enzymes attach it to the 3' hydroxyl group (though PheRS is an exception); they are mostly dimeric proteins. Class II enzymes possess an unrelated b-sheet arrangement and are characterized by three degenerate sequence motifs.

Aminoacyl groups attached to the 2' hydroxyl group of the terminal ribose by Class I enzymes, however, cannot be used during protein synthesis. The aminoacyl group in these cases is subsequently transferred by a transesterification reaction from the 2' hydroxyl to the 3' hydroxyl of the 3' terminal nucleotide.

 

Mechanism of tRNA Recognition

The mechanism by which aaRSs recognize the correct tRNA is complex. Some enzymes recognize features in the acceptor stem, some recognize the anticodon, some recognize both, some recognize a combination of sequences and structural features in the cognate tRNAs.

[26-9] [26-10]

This question is an example of a more general one: how do proteins recognize RNA? While DNA binding proteins can recognize and hydrogen bond with suitable donor or acceptor groups in the major and minor grooves of a double helix, RNA has no fixed structure. Rather, the conformation of any given RNA molecule is a combination of single-strand regions and double-strand regions. The former can appear as loops or bulges. The latter will adopt an "A" conformation which has a much deeper major groove than B-DNA and is, therefore, not as suitable for the kinds of interactions seen in DNA-binding proteins.

The mechanisms by which aaRSs recognize their cognate tRNAs has been called a second genetic code. This is overly simplistic since the rules are clearly very complex and appear to be different for different tRNA-aaRS combinations.

To a limited extent, it is possible to distinguish between Class I and Class II aaRSs on the basis of the way in which they recognise tRNA. Many Class I enzymes require the anticodon for proper recognition; many Class II enzymes recognize only features in the acceptor stem.

 

• The Class I enzyme MetRS recognizes two tRNAs -- the initiator tRNA_f^Met and the elongation tRNA^Met.
  
  Recognition occurs through interactions with the anticodon, in which the bases of the anticodon loop are probably unstacked so that their interactions with the enzyme can be maximized.
  
  A tRNA with a structure similar to that of the two tRNA^Mets can also be recognized by the MetRS enzyme. If the anticodon of tRNA^Val is changed from UAC to CAU, the modified tRNA will be recognized by MetRS and methionine will be added instead of valine.
  
  Similarly, ValRS normally recognizes and aminoacylates only tRNA^Val. However, it can also recognize the structurally related tRNA^Met. If the anticodon of tRNA^Met is changed from CAU to UAC, the modified tRNA will be recognized by ValRS and valine will be added instead of methionine.
  
  [26-11]
  
  
• The features of tRNA^Ala recognized by E. coli AlaRS (a Class II enzyme) seem, on the other hand, to be remarkably simple.
  
  The single determinant seems to be a G­U pair at the third position in the acceptor stem (i.e. G3­U70). tRNA^Ala is the only tRNA in E. coli with a G­U pair at this position.
  
  [S34-14]
  
  AlaRS will charge a number of different structures with Alanine as long as this position contains the G­U pair:
  
  • A 24 nt microhelix derived from tRNA^Ala in which the nucleotides from positions 14 to 65, inclusive, have been deleted is a substrate for AlaRS. This microhelix is missing the anticodon loop completely.
    
    
  • tRNA^Cys and tRNA^Phe can both be charged with alanine if a G­U pair is introduced in the analogous positions of their acceptor stems.
    
    

[26-12]

 

• The following image - from Dieter Soll's web pages - shows the identity elements in Escherichia coli tRNA^Glu:

 

[26-13a] [26-13b] [26-14]

 

Mechanism of Amino Acid Recognition

As it is essential that the correct amino acid be added to the tRNA, there are two ways in which errors are kept to a minimum:

Preferentially bind the correct (cognate) amino acid to the enzyme active site

Selectively edit the incorrect (non-cognate) amino acid at the enzyme proof-reading site.

Recognition of the correct amino acid occurs in a manner analogous to that by which all enzymes recognize their substrates. Each amino acid will fit into an active site pocket in the aaRS where it will bind through a network of hydrogen bonds, electrostatic and hydrophobic interactions. Only amino acids with a sufficient number of favourable interactions will bind.

[S34-8]

Since some amino acids have very similar side chains, a proof-reading mechanism makes sure that the correct amino acid is chosen. For example, IleRS charges tRNA^Ile with isoleucine approximately 60,000 times more frequently than it does with valine. However, these two amino acids are much too similar for this degree of discrimination. In fact, the mechanism of catalysis can discriminate between the two amino acids only by a factor of 225. However, by adding a proof-reading mechanism, which occurs at a separate site on the enzyme, the total degree of discrimination (60,000 = 225 x 270) can be obtained.

[S34-12] [S34-13]

Not all aaRSs have proof-reading mechanisms. If the enzyme side-chain can be distinguished adequately well from any similar side-chains, then proof-reading is not necessary.

Ribosomes

The ribosomes are complex ribonucleoprotein complexes. They consist of two ribonucleoprotein subunits: a smaller subunit and a larger subunit. The sizes and exact composition of each subunit is basically the same in all organisms though the exact details are, of course, different.

[MVH27-25]

The small subunit

The small ribosomal subunit has a sedimentation coefficient of 30S in bacteria and 40S in eukaryotes. It contains a single rRNA, which is the 16S in prokaryotes and the 18S in eukaryotes. The number of proteins varies from 21 in prokaryotes to 33 or so in eukaryotes.

In prokaryotes, the 16S rRNA is essential for recognizing the 5' end of mRNA and hence positioning it correctly on the ribosome. The 16S rRNA has a characteristic secondary structure in which half of the nucleotides are base-paired. The 16S rRNA sequence has been highly conserved and is often used for evolutionary and species comparative analysis.

The image at right shows a picture of the secondary structure of the 16S rRNA from the cyanobacterium Synechococcus sp. PCC 6301: (Click the image for a larger view)

[S34-19]

 

 

The large subunit

 

The large (50S) subunit of the E. coli ribosome contains 34 proteins and two rRNAs: 5S and 23S. The 23S rRNA is the real catalytic agent in peptide bond formation. Both rRNA molecules adopt a compact base-paired structure. One protein (the L7=L12 protein) is present in 4 copies -- all others are present as a single copy. One protein (L26) is the same as a protein (S20) in the small subunit. The large (60S) subunit of eukaryotic ribosomes contains approximately 50 proteins and 3 rRNA molecules: 28S, 5.8S and 5S. The 28S and 5.8S rRNA are both related to the bacterial 23S rRNA. The 5.8S rRNA is similar in sequence to the 5' end of the 23S rRNA so its existence is probably a result of some ancient mutation that divided the ancestral gene in two.

The picture above from Dr. Nenad Ban's homepage shows the structure of the 23S rRNA (grey) from Haloarcula marismortui. Ribosomal proteins are shown in yellow. The catalytic ccentre is right where the star shines!! This perspective is that from the 30S subunit.

 

The 23S rRNA has a characteristic secondary structure. The following image shows a picture (in 2 parts, because of the size) of the secondary structure of the 23S rRNA from the cyanobacterium Synechococcus sp. PCC 6301:

(Click the images for a larger view)

The crystal structure of the ribosome from the Thermus thermophilus was determined to 7.8 Å resolution in 1999. This enabled us to see, for the first time, the details of the various tRNA, mRNA and factor binding sites. More recently, the structure of the 23S and 5S rRNA molecules were solved to 2.4 A resoultion and fitted to the structure of the Haloarcula marismortui large subunit.

The top image shows the structure of the 70S ribosome. You can see how a tRNA interacts with the 30S subunit because of anticodon-codon bonds; and it interacts with the 50S subunit throught the positioning of the attached amino-acid for catalysis. Note that the nascent polypeptide chain must leave the ribosome through an exit channel. This is conceptually the same as for newly-synthesized RNA and RNA polymerase. The bottom images show the two separate ribosomal subunits. In each case, you can see the three tRNA binding sites and you can easily imagine how a tRNA moves through the ribosome from the A-site to the P-site to the E-site. Note also how the amino-acid attached to the tRNA in the A-site is positioned close to the peptidyl chain attached to the tRNA in the P-site. This, of course, is ideal for catalysis of peptide bond formation.

Image from:

Functional is Structure. Anders Liljas. Science 285: 2077-2078 (1999)

[26-17a][26-17b]

The Haloarcula marismortui structure shown in the following image is illustrated from the perspective of the small subunit. The nuances of shading make it possible to imagine how tRNAs and other factors can enter the ribosome during protein synthesis.

 

Image from Poul Nissen's Home Page

The messenger RNA

The mRNA must contain some feature that allows its 5' end to be recognized by and positioned correctly on the ribosome during the assembly of the protein synthesizing apparatus. In bacteria, a special ribosome binding site was identified by John Shine and Lynn Dalgarno in 1974. They observed that the 3' end of the 16S rRNA is complementary to a short region just upstream of the start codon in bacterial mRNA.

thr A GGUAACCAGGUAACAACCAUG 16S rRNA 3'-AUUCCUCCACUAG... lac Z UUCACACAGGAAACAGCUAUG 16S rRNA 3'-AUUCCUCCACUAG... gal E AGCCUAAUGGAGCGAAUUAUG 16S rRNA 3'-AUUCCUCCACUAG... ara B UUUGGAUGGAGUGAAACGAUG 16S rRNA 3'-AUUCCUCCACUAG... trp A AGCACGAGGGGAAAUCUGAUG 16S rRNA 3'-AUUCCUCCACUAG... lac I CAAUUCAGGGUGGUGAAUGUG 16S rRNA 3'-AUUCCUCCACUAG...

[26-26] [S34-27][S34-28]

The ribosome binding site is frequently called the Shine-Dalgarno sequence.

In eukaryotes, it is the 5' cap structure that is added to the mRNA which is required for correct positioning of the ribosome on the mRNA during the initiation phase of protein synthesis.

Ancillary Protein "Factors"

Each of the steps of protein synthesis requires the participation of a number of additional special protein factors. Each factor has a specific role to play which will be described in Protein Synthesis: The Nine Steps. Some of the factors are G-proteins -- they bind GTP and GTP hydrolysis is an important part of their function.

Initiation	Elongation	Termination	Disassembly
IF1 IF2 (GTP) IF3	EF-Tu (GTP) EF-Ts EF-G (GTP)	RF1 RF2 RF3 (GTP)	ribosome recycling factor (RRF)

A special tRNA for Initiation

In bacteria, protein synthesis starts with a special amino acid: N-formyl-methionine. Addition of the formyl group to the N-terminal methionine effectively provides it with a peptide bond.

[26-fMet.jpg]

This amino acid is synthesized by modifying methionine after it has been attached to a special tRNA -- tRNA_f^Met. The same MetRS aminoacylates both tRNA^Met and tRNA_f^Met.

[S34-26]

tRNA_f^Met is structurally different from the "regular" tRNA^Met in a number of ways:

• It contains 3 consecutive G­C base pairs in the anticodon stem.
  
  
• The terminal bases of the acceptor arm are not paired as they are in all other tRNAs.

 

tRNA_f^Met is functionally different from the "regular" tRNA^Met in two important ways:

• It is recognized by a special enzyme that will catalyse the formylation of methionyl-tRNA_f^Met -- transformylase.
  
  Transformylase catalyses the formylation of the methionyl-tRNA_f^Met but not of methionyl-tRNA^Met or uncharged tRNA. The enzyme uses N¹⁰-formyltetrahydrofolate as the formyl group donor.
  
  
• It is recognized by a special Initiation Factor -- IF2 -- which recognizes fmet-tRNA_f^Met but not Met-tRNA^Met and brings it to the ribosome during the initiation phase of protein synthesis.

 

The presence of the formyl group on the methionine after it has been attached to tRNA_f^Met serves two purposes:

• It ensures that this will be the only charged tRNA that is be positioned in the peptidyl site on the ribosome to start protein synthesis.
  
  
• It ensures that this tRNA will not be used for internal methionine codons.

 

Eukaryotic protein synthesis also begins with methionine but the methionine is not modified. A special tRNA -- tRNA_i^Met, where i stands for initiator -- is required, however.

comparison/contrast of Ingredients in prokaryotes and eukaryotes.
prokaryotes	eukaryotes
small subunit 30S 16S rRNA 21 proteins	small subunit 40S 18S rRNA ~33 proteins
large subunit 50S 23S rRNA   34 proteins	large subunit 60S 5S rRNA 5.8S and 28S rRNA ~50 proteins
ribosome binding site tRNAfMet N-formyl-methionine	5' mRNA cap structure tRNAiMet methionine